Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415877
Length 402 bp
Fasta Format > MUG002.A02R990520
AACCAAACCCCAGCTCCATGGCGACGGTGGCGATGGACATCTCGAAGCCC CCGCCGGCCGCGTCCGGCGACGAGTCGGCCAAGGGCGCGCGTGGCGGAGG CGAGGGGTTGCGCCAGTACTACCTGCAGCACATCCACGACCTGCAGCTCC AGATCCGCCAGAAGACGCACAACCTCAACCGCCTCGAGGCCCAGCGCAAC GACCTCAACTCCCGAGTTAGAATGCTTAGGGAAGAGCTACAGTTACTCCA AGAGCCTGGCTCTTATGTTGGTGAGGTGGTGAAGGTCATGGGCAAATCAA AGGTTCTAGTTAANGTGCATCCAGANNGCNAATATGTAGTAGATATTGAT NAGAGCATCGATATCACNAAAATCACACCTTCANCNAGAGTTGCTCTTCN GG
Download
page-top