Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415874
Length 361 bp
Fasta Format > MUG001.H11R990520
CGGCACGAGGAGACATACGAGCGCGTGGAGTCCTCAAAAGGGGAGCATGA GCTCCTGATGGAGCGGAACCGCCTGGATGCCGCACGCGAGCTGGAGGACC AGCGTGTACAGTTCTTCCTCAAGATGCAGATGGAGATCTCGAAGGCCAAC AATGGTGCTCCACTCGCTGTCCCACTTGCTGCCGCTGCCATGGTCGGTAA TTCAGCCTCTACAGCAGAAGATGGCGACTCGCCAGCTACTGCTGATGGCA ACGGTCCAAGGAGAGCCTCTATGGCAACCGATGACATGGCCAGCAGCAAT CACCATGTCCGGTACCGTGTCAAGGACGACAGGCATCACCATGCCTCACA GCGCCCATCTT
Download
page-top