Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415871
Length 578 bp
Fasta Format > MUG001.H08R990520
CGAATGAAGAGGTATGCGATGTTGCCCGCAAGCGAATACTCTTATGGCAT AAAAAGAACGGGGTAAACTTATCATCGGCCCAACGTAGCGGTGACTCCCC AGATCCAGCGGCTCAAGCAGCTGCTGAATGCTTGTAGAAGCTTGCTCTCC AGAAGGGGAGCAAGGACAACATCACGGTTATTGTGGTAGACCTAAGGCGC AGAGGAAGTTCAAGAGCAAAACTTAAGTCATCTTGCTTGATGGACAGCCT CTATGACAAATTCCTAGGAATCTATATAGATTTGGAGAATCCAAATTCGA TCAGTTTAGACTGTTGTGTTAGTACATTACTTAGCCCAGTTCGTTCTTTT CTTCCTTTTCAACATTTGGGCTGCCAAGGGCTGTATTCCTGTATACAGTA CAGATTACGAAATTCCGCATCAGGGTTTATGTTTCCTGATGGCGTGGGTG ATCCTGTTTTCTGTTCTTCTTCCTTTGCTGCCCCTTATTCTTTTTCTTAA GCTGGGCCATCATGTATCTGGAAATGTATATTTGAGCCTGTAGGGTACAA CAGGAACTAGTGGTATAAACTATTTTGT
Download
page-top