Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415857
Length 1010 bp
Fasta Format > MUG001.G06R990520
GGACAACCTTTCTATACCCAAGTGCTGTTGATCAATTTAGGAAGCAGTTT GCTCATCTTGAAGAAAATAGTGAGAACGGCCCTGTAGTTCCAATGGATAG AAAGCACACCTCTCTTCCTAGGTCTACTATTGTTCACTCAGCTCCAATTC ATGGCAAGGAACAACCCCGTATTGGCCCATCAAGGGATAAGCCTTCGCCT GACGAGTCTTATAAAAATCATCGAGATTCAGAAAAATATTCTGGCAATGT CCAGAGAACCTCACAGGCTCCACAAAGAGTGCCAACAGCAAGACCAGGAA GGGTTGTTGGTCCAGTTCTGCCTTACGAAAATGGTGGCATGAAGGATACA TATGACCCACGAAGAGTGGCAGCAATGAACTCCGGTTATCCTCCCCAACA ACAAATCCCGCAAATATACGGTTATTATCAGACACCGGCAAAGTCAGCTT GCTCCGAGCCATCGCAGGCCGAAATGTATACGCTGCACCAGCAGGCCTAT GCTTGCGCAAACAGTTCAACTGTGCCTGATGTTGCTCTGGACATGAGAGC ACCTCCCTTCCATCAGTCAGCAGGGCCGAAAAGGGGTTCTTCTGATAGGC TATCAGCGGAATCAAAACCTATACTCGAGATCCCTTAATGGCATAGCTCC AACTACAACAGGAGTGGCGGCAAGTGCTCACACGGAAAGGTCGGCGTTGT CCCTACGTATGTCGCAGATGTTTTAGTGGGCCAGTCAAGGGGCATCCGAA TGTCCTTCCTGTAATTGCGGCCTGTGTGCTTAGCGAAACAGGGAAAACGC AACGGGCGANAGCTGGTGGGGGATCCCCAGGTTTCACGCGGCACCCCGGT TATACATGTTGCTGCGTGACGTAANGTGTTAACTCTCNTCGGTTGNCCNC GTGTTTTCTGTACCACAGGGGGTGTACCCACGAGATTATNATATGAACGC TCTTATGCNCAGAAAAAGANCCCAGTANTANGTCGGAATTATAAGTNACA GACGTCNCAN
Download
page-top