Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415856
Length 635 bp
Fasta Format > MUG001.G05R990520
GAAATCCCAATCTCCAAAGCCGCAGCGCAGCAGCAGCCAGATCCCCATCC CCTCCACCACGATGGCCCGCACGAAGCAGACGGCCCGCAAGTCCACCGGC GGCAAGGCGCCGAGGAAGCAGCTCGCCACCAAGGCGGCGCGCAAGTCGGC GCCGGCCACCGGCGGCGTGAAGAAGCCCCACCGCTTCAGGCCGGGAACGG TCGCCCTCCGCGAGATCCGCAAGTACCAGAAGAGCACGGAGCTGCTCATC CGCAAGCTCCCCTTCCAGCGCCTCGTCCGTGAGATCGCGCAGGACTTCAA GACCGACCTCCGCTTCCAGAGCTCCGCCGTCTCCGCCCTGCAGGAGGCCG CCGAGGCCTACCTCGTCGGGCTGTTCGAGGACACCAACCTCTGCGCCATC CACGCCAAGCGCGTCACCATCATGCCCAAGGACATCCAGCTCGCCCGCCG CATCCGAGGGGAGAGGGCCTAGGTTCTGGGTCGCCGGTAATACTGGCTAG TAGCTGTTCTTGTCTTGTGATCCGGATGTGTGTCGGGTGCTTCTGTTTGT TGGTGTTGATATGATGTGTCGTCTTATCCTAATGTATTGTGATGCTTGAA TGAAATTGCAATGGAAAAGGTTCAGTTATCGTGCC
Download
page-top