Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415855
Length 663 bp
Fasta Format > MUG001.G04R990520
GTTCCATCCAGGACTCCCAAGAAGAAAGAGGGATCAGCATCAGGTTCAGG ATCAGGTTCAGTGTCCAAGGATGTCGCAGGACGGCGGGCTAGAAGGGCTC AGAAGCGGGAGGCTGCTGACAAGGCGGCTGCAGAGAAGCACCTCAAGCTC CTGCAGAGGCTGGGCCGCGGGAAAACTCCCGAAGCGCCACCTGAAGCACC ACCGGAATCACTGGAGGTTGGTCCTCCAGCGCCACTCGAGGTTGGTCCTC CTGTGATCGGGTGATCCATCAACCTCTGTAGATAACGGTGCTGCGGGGAA TGCTGCAGCCCCTGGGAGCCCCTCCAATAATTCTCCCGGTGCGAAGAAGA GGAAACCGGGCCTTGTATCCTGGCAACTTTGTCGCGTTGTACACTAATTT TAGCTTCGAGTCACTCGTTAGGTCGGTCATCGGAGCTGCTACCCAGTCTG CTCCAGATGCAGCGATGTGGTCGGTCGGTCGGTTTATCCCACACTGATAG TTGTTTAATTCAAGTCATGTACTCGTGTCGTATTAGGGGGGGCACAAAAA TTGCTTGCTGTGCTAATTTTCCTGGCAATGTGGCATTCTGGTANGTTGTT TACATCCATTCAACCCCAAAAATGAAAGATTGACACTGGGGGAACCGGAA GTCTTTACTGTGG
Download
page-top