Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415852
Length 314 bp
Fasta Format > MUG001.G01R990520
CAGGAGGCCGCCGAGGCCTACCTGGTGGGGCTGTTCGAGGACACCAACCT CTGCGCCATCCACGCCAAGCGCGTCACCATCATGCCCAAGGACATCCAGC TCGCCCGCCGCATCCGTGGCGAGAGGGCCTAGGCCGCGATCTGCAATCCA TGCGTCGTCTGTTAGATCCTTGTTAGGAAGTGCGTGTGCTAGTAGTGTTT CAGAATGTGCCTGTGTTGTTCTTGTCATGGTGGATCTGTTATGCCTAATC TGATGGTACCTTCTTGTTGCTATCATCTATGGAAATGAAAAATGTTGGCT TCCTGTTCTCATTC
Download
page-top