Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415850
Length 471 bp
Fasta Format > MUG001.F11R990520
CGAACCAGTACGAGAGCACGTCGCTGGTGCAGGTCGAGGGGGTGAACACC AAGGAGGACGTGGCGTGGTACGCCGGGAAGCGCCTGCGTACGTGTACAAG GCCAAGACCAAGAGCAACGGCACCCACTACCGCTGCCTCTGGGGCAAGAT CACCCGCCCGCACGGCAACTCCGGCGTCGTCCGCGCCCAGTTCAAGTCCA ACCTCCCCGCCGAGTCCATGGGGCGCAAGGTCAGGGTGTTCATGTACCCG AGCAGCATCTAAGGTTTTTTTGATCTAGGGACAGTAATGCTTGTTTCTTG TGATTGTCATGAGCTGAGAAATGTCATTTTATGGTGAATCTATGCTATGT TGGCAACCGAAACTGATCATGTATTCCGAGAACCTGTGGAAGTTTTGGCT AGACTTGTTTGTCAAATGTGCGGACCATTTTAGTATATTTCTATATCAGC ACTAAAGCGTAATTTGTCATG
Download
page-top