Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415848
Length 650 bp
Fasta Format > MUG001.F09R990520
GTTCCATCCAGGACTCCCAAGAAGAAAGAGGGATCAGCATCAGGTTCAGG ATCAGGTTCAGTGTCCAAGATGTCGCAGACGGCGGGCTAAANGGCTCAAA GCGGGAGGCTGCTGACAAGGCGGCTGCAGAGAAGCACCTCAAGCTCCTGC AGAGGCTGGGCCGCGGGAAAACTCCCGAAGCGCCACCTGAAGCACCACCG GAATCACTGGAGGTTGGTCCTCCAGCGCCACTCGAGGTTGGTCCTCCTGT GATCGGGTGATCCATCAACCTCTGTAGATAACGGTGCTGCGGGGAATGCT GCAGCCCCTGGGAGCCCCTCCAATAATTCTCCCGGTGCGAAGAAGAGGAA ACCGGGCCTTGTATCCTGGCAACTTTGTCGCGTTGTACACTAATTTTAGC TTCGAGTCACTCGTTAGGTCGGTCATCGGAGCTGCTACCCAGTCTGCTCC AGATGCAGCGATGTGGTCGGTCGGTCGGTTTATCCCACACTGATAGTTGT TTAATTCAAGTCATGTACTCGTGTCGTATTAGGGGGGCACAAAAATTGCT TGCTGTGCTAATTTTCCTGGCAATGTGGCAATTCTGGTAGGTTGTTTACA TCCATCAACCCAAAATGAAAATGAAATGGGGGAACNGGAGTCTTACTGTG
Download
page-top