Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415846
Length 556 bp
Fasta Format > MUG001.F07R990520
AGAGCACTCTATGATTTAGTGAAGGAGGAGAACAACCCTGTTGGGTATGG GATGAATCTCATGCAAGTAAAGATCGCGAGTGANAAAGGGAGCTCTGGTA TTGGATGGCAGGGAAATGTTATTGGGATCCCTACATGGAGGCTTGGGAGG TCCATTCTCTTACTTTGTCTTGCTCTGTCGCATACTACCGTTCCTGAGAA AATATGGCATANATCCGTGTGTGGGGTAGTAATTTGTCCATGCTCATTCC TGTCCAGAGGACATGCCACTCCCACTGCTATTGGTGTTTCTTGACAGCAA TGTTGGTTCCGATTGCTTCATTGGCAAGTACATGCACAAATGGAGACCAC CCTGCAGCAGTTCATAAAGTTGGAGTCAAGTTATCTCTCTGTTGACAAAC ATTATCTTACGTCGCTCTCTGGTTTGAACTCCATGTTAGGATACACTACG TGACGTTTCTGTCTTATCTAAACCGAGCTCTGCCTTCTGTTACCAGTTGA GTTTATGAGTTACGGGGTCCACAGGGCCAACCTTAGGCATCGATGCTATT TTGCTT
Download
page-top