Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415842
Length 677 bp
Fasta Format > MUG001.F03R990520
GAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTAGTACCACAACCGCAA CATTTTCTAGATAGATTTCATTTTGCAAAAGCAACACGTTCAGTTCTCAC AACCAAGAAGCCAACAAAGCGTTGGCAATCTTCTACCACACGAACTACTA CCACTACTTCTACTTGCAGGTAAGCAGAGTCAACAGCAGAGATACATCAG ACAGCCACATCTGGCACAACAAGCGGCGCATCTTCAGTCTAGGAGGAGGT GAACTTGGTGACGGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCT CCCCGGGGAGGACGAGGCGGACGGAGGTCTGGATCTCCCGGGAGGTGATG GTGGGCTTCTTGTTGTANCGGGCGAGCTTGGCCGACTCCCCGGCGAGCTT CTCGAAGATGTCGTTGATGAAGGAGTTCATGATGGACATGGCCTTGGAGG AGATGCCGATGTCGGGGTGCACCTGCTTCAGCACCTTGAAGATGTAGATC TTGTACGTCTCCACGCCCTTCTTGGCCTTGCTGCCCTTCTTGCGGCCCCG GGTCTTGCCCTCGCCGCCGGCCTCCTTGGACGCCGTCTTGCCCGCCGGCA GCCCGNTTCTCGGCTTGGGCTTCTTGCCCGCGGGGGTCTTCTCCGGCGGC TTCTCGAACTTGGTCCTCGGNGGGCGG
Download
page-top