Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415838
Length 655 bp
Fasta Format > MUG001.E11R990520
AATTTGAGGAGAATTACGTAAAGGGTCTTGATTACGATCCTGACCGAGAA AGGGCACGCCTGAAGAAGCTGGCGAAACAAGTGAAGAGCGAGAAGAGAGG TGCGATGTCCGAGCTTCGCAAAGATAGTTATTTCATGGCTGCTGTGAAAC AGAAGGAGAGGGCGAGACACGAGCAAGAGAGGTCTGAAAAGTATGGCAAA GCAATGGCTTTTCTTCAAGAACAAGAAAGCGCTTTTAAATGCGGGCAGAT GGGAAAAGGCAAAAAAAGGAGGAGGTGATGATATGCTGATCATGTTGCTA TCACAGTCCAGTTTGCGCTGGGTATTGGAGATAGAAAATTANGCATGCAC CTGGTGACCCTGGCATGCCCCGCTTTAACTGCCTTTGCCACTTCCATGTC GAAGACACGCCGGAAAGAGTAATCATGTCGCAAACGCTGATGTGGATGGA CGCGTTATGTTTCTTGCACTTGAGAATGAGTTGCTCCGGAGTGCTGTACT CGTGCAATAGTAGTAATCTGATGTAACGCAGGAGCGATTTTGTTTGCTTT TTTGTCCTGATTTCTTGTATGCAGTGTTACTCTTCAGACTTATGTGAACC AGTCCTGTTCATCTTGTTGCTTTTCCCAAATTAATGGGAAGACATCCTAC ACTGC
Download
page-top