Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415836
Length 715 bp
Fasta Format > MUG001.E09R990520
TGGACAACCTTTCTATACCCAAGTGCTGTTGATCAATTTAGGAAGCAGTT TGCTCATCTTGAAGAAAATAGTGAGAACGGCCCTGTAGTTCCAATGGATA GAAAGCACACCTCTCTTCCTAGGTCTACTATTGTTCACTCAGCTCCAATT CATGGCAAGGAACAACCCCGTATTGGCCCATCAAGGGATAAGCCTTCGCC TGACGAGTCTTATAAAAATCATCGAGATTCAGAAAAATATTCTGGCAATG TCCAGAGAACCTCACAGGCTCCACAAAGAGTGCCAACAGCAAGACCAGGA AGGGTTGTTGGTCCAGTTCTGCCTTACGAAAATGGTGGCATGAAGGATAC ATATGACCCACGAAGAGTGGCAGCAATGAACTCCGGTTATCCTCCCCAAC AACAAATCCCGCAAATATACGGTTATTATCAGACACCGGCAAAGTCAGCT TGCTCCGAGCCATCGCAGGCCGAAATGTATACGCTGCACCAGCAGGCCTA TGCTTGCGCAAACAGTTCAACTGTGCCTGATGTTGCTCTGGACATGAGAG CACCTCCCTTCCATCAGTCAGCAGGGCCGAAAAGGGGTTCTTCTGATAGG CTATCAGCGGAATCNAACCTATACTCGAGATCCCTTAATGGCATAGCTCC CAACTACACAGGCAGTGGGCGGGAAGTGGCTCACAGGGAAAGGTCCGNCG GTTGGTCCCCTACGG
Download
page-top