Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415831
Length 693 bp
Fasta Format > MUG001.E04R990520
CTGAAGGTGCCAGCGTCGGTGAGGGAATTTATCAATGTGGAATGCTCATC ACCTCATAGGGAAGATCTGAACCAAGTGAATGCAAGGATTTTTTGGCAAT GTCTAGCTCAATCTCACCTTCGAGAAAATGTAATATTTTTCCTCCGGAGT TAGTCTACACTATCCAGGTTGTATGCTACTACTGAGATCCCATCAAGGTA ACACTCTTCCCCCACATCTTAATCTGCAAGAAAAGTATAAACAAGATTCA AGTGAGCGGTCTTCATGGGGTTGCTTGTACGTATGATTTGTTCATGTGCT TCATTTTGTAATTCTAGTCAAGTAAAGGCTAAAGAAACATGCTACCCTCA AACTGAAGTTTTGCAACCATGTTAATATTTAATGCAAATTGCCAAGACTC TTCTGGGAGGATTATGTTTATCTCTGTAACTAGCTGTTAGCATTTTCCTG TTCAACAATAAAGGTCGACATCACTACAGGAAATGGTTCTGATTGTTACT TCGATTCAAACTCATGAATTAAGTTAAAGTCTACATATGAGGTTGTGTTT CAGCCATGCATACTTTGTGTGCCTGTGTTGTNTGTGTTGAGTTTGGTTTA GTGGTATATGAGCTGTGTTGTGTTGNGGNGCCCCTGTCGGGCCGNTATTT NCNGGGTTCAACGATATTGATTGACNTCTCTTCCTGTTGGAGT
Download
page-top