Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415830
Length 874 bp
Fasta Format > MUG001.E03R990520
CGGCACGAGAACCAAACCCCAGCTCCATGGCGACGGTGGCGATGGACATC TCGAAGCCCCCGCCGGCCGCGTCCGGCGACGAGTCGGCCAAGGGCGCGCG TGGCGGAGGCGAGGGGTTGCGCCAGTACTACCTGCAGCACATCCACGACC TGCAGCTCCAGATCCGCCAGAAGACGCACAACCTCAACCGCCTCGAGGCC CAGCGCAACGACCTCAACTCCCGAGTTAGAATGCTTAGGGAAGAGCTACA GTTACTCCAAGAGCCTGGCTCTTATGTTGGTGAGGTGGTGAAGGTCATGG GCAAATCAAAGGTTCTAGTTAAGGTGCATCCAGAAGGCAAATATGTAGTA GATATTGATAAGAGCATCGATATCACAAAAATCACACCTTCAACAAGAGT TGCTCTTCGGAATGATAGCTATATGCTTCATTTGGTCCTTCCAAGCAAAG TTGATCCACTGGTCAATCTTATGAAAGTTGAGAAGGTCCCAGATTCTACA TATGATATGATTGGAGGTCTTGATCAGCAAATCAAGGAGATCCAAGAGGT CATCGAGCTTCCTATCAAACATCCTGAGTTATTTGAGAGCCTTGGAATTG CGCAGCCCAAGGTGTCCTCCTTTATGGACCACAGGGACAGGCAAAACATT ACCTGGCNACCGTGCCAGTTGCTCCACTTCACACCCGAACTGTACCCTTA TNCCAAGAGGGAAATNCCTGGGGTCCTAGAGNTTGGGTCCAAAAAGAGTA ATTTGGGAAANGGGCCCCCGCGATANGNTCTCACGGAAACACCTCNNGTG ATAGCTACAGNGAGGACTGNTCCCCCGCCANANNATTATCNACCGGAGTG ANAAAACACCCCCCGGCGTCGCTA
Download
page-top