Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415823
Length 777 bp
Fasta Format > MUG001.D08R990520
TCTCCCGCCGCCGCCGCAGCCGCCGCCTGCCTCGAGCCGCCGTCGCCATG GGGAGAAGACCTGCGAGGTGCTATCGGCAGATCAAGAACAAGCCATACCC CAAGTCAAGGTACTGCCGTGGTGTGCCTGACCCTAAGATCAGGATCTATG ATGTCGGCATGAAGAAGAAGGGTGTCGATGAGTTCTCTCACTGTGTTCAC CTTGTCTCATGGGAGAAGGAGAATGTGTCCAGTGAGGCTCTTGAGGCTGC CCGTATTGCTTGCAACAAGTACATGACTAAGCATGCAGGAAAGGATGCCT TCCACCTCAGGGTCAGGGTTCACCCGTTCCATGTGCTCCGTATCAACAAG ATGCTTTCGTGTGCCGGGGCTGATAGGCTCCAGACTGGTATGAGGGGTGC TTTCGGGAAGCCGCAGGGAGTCTGTGCCCGTGTTGCCATTGGGCAGGTCC TCCTTTCTGTGCGGTGCAAGCCCAACAATGCCATCCATGCTACTGAGGCC CTTCGTCGTGCCAAGTTCAAGTTCCCTGGCCGNNCAAAAGATCATTGAGA GCAGGAAGTGGGGCTTCACCAAGTTCAANCGCNAATGACTACTCAAGTTC AAGAGTGANGGCAGGATCTTGCCTGATGGAGTCACGCTAAGCTGNTCGGA TGCATGGCGCTTGCAAACCGNGGCCCCTGTGACCAAGGCTTTTCCTGTCT GGCGGATNATCTNAGCGAAAAAGGTCTATCGGGGCTATCTCGAAACGTTT TTTTCCGGGTTGGNACATTAATTCCAC
Download
page-top