Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415822
Length 711 bp
Fasta Format > MUG001.D07R990520
TCGAGTTTTTTTTTTTTTTTTTTAGCAAAGGTTCTTTACTTGGCACAGCA TGGTAACATGAGTACACCAGAGTACAAGCAATATCCTCATAACACGACGA AATTGATAACAGAGACATATCCTGGAATCACTTCCTAGCTTGCATAACAA ACACTGAAACGTCCATAAAACAAAATGCAGATAACTCTTGAGCCATGGCT CCACCACGCCGCGGCCGGGCGGGCCGGATCTAGAACCCGAGCTTGGTGCG GCGCCAGTGCCTGCGCTTCGCGTTGTACCTGATGGTGTTGTCGGTCCGCA TGCGGATCCAGTAGGGGATGGGGCGGTTCTGGCGCTGCTTCTTGGCCAGC TTCTGCTTGATGCGGAAGGTCTTGTGGGACGGCATCGTCGCGGCGGAGAC GAAGACGCAGCGGCGGCTTCGGCGTCGGCGGCGGCTGCGGCGGCGGCGCT CGTGCCGAATTCGGCACGAGGTTCCAAGGGCCCAAAGATTGGCGGTGGCG GCGGGAAGCGTTGAAAGTCGATTACGCCATAGACATAGAATTGTGCTGCC CTAGCCTTGTTTCCTATCCTACTATCATAGACCTTTGTCAAAGTTATTAC CCCGCATCTTGAATTTGCACCTTTATCTGTGAGGCTGAATGGTGTTAACG TTTTGGATTGTCTCGATGAGTTTATTTATAATGAAATGGGTACTTAATGT GGGTCTTGGTC
Download
page-top