Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415821
Length 367 bp
Fasta Format > MUG001.D06R990520
GCACTAGTGGCTCGTCCGGCAGCAGTGGCGTGGTCGGCATTCATGGTGCT GCCAATCCCTGATCGTGTTGTTGTCTGTCTTGGTGTCTTGATGTTTAAGA TTGCTCTTTANAGCCATGCAGGTGCAGCATTCTACCGTGGTGGTAGAGAG TAAGCTTCTTGCTTGCTCTAGTTTAGCAGTATTGTGTTATGGCTTATGTG TGTGTTGTTTTCAAGTGATCTGTGTCCCGTGTCTTTGTAAAAGACTTGTT CTTGGCTGTTATTTAACCTTGTGTACTTCTTAGATGTTGTATTGCTGTCG TGGGTTCGAAGTCCCTTTGCTGTATCTTTGATTTGGAGAGTGAGGGTTTG AACCCATGAGCTGGATC
Download
page-top