Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415820
Length 349 bp
Fasta Format > MUG001.D05R990520
GCTCCTTCCGCGATGACGCCTTCCGCGGTCGCCGGAGCACCCGCGGGCGC ACCTGCCGGCGCGCCCAGCGGCACCACCCCCGCCAGCTCCGCCGTCTACG CCTCCTCCGTCAGCTTCGTCGCCGTCGCCGGTGCCGTCGCCGCCGCCGTC ATGTTCTAAAGATGCAGCGGGTCCTCGCTCCGGACCGCCGCGGGAGTGCC ACTCTGTTTTCATTAGTAGTACTGTTGTTTATACAACGAGATTCATTTTT TAGAGGCTGCGGAGAGAGTGACATGACATGACATTGCCATGTTATCTTGC TACATACTGTATGCTCGAGGTCATTATTAATAGAATTCTTTCATTTGTT
Download
page-top