Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415817
Length 366 bp
Fasta Format > MUG001.D02R990520
GCACTAGTGGCTCGTCCGGCAGCAGTGGCGTGGTCGGCATTCATGGTGCT GCCAATCCCTGATCGTGTTGTTGTCTGTCTTGGTGTCTTGATGTTTAAGA TTGCTCTTTAAGCCATGCAGGTGCAGCATTCTACCGTGGTGGTAGAGAGT AAGCTTCTTGCTTGCTCTAGTTTAGCAGTATTGTGTTATGGCTTATGTGT GTGTTGTTTTCAAGTGATCTGTGTCCCGTGTCTTTGTAAAAGACTTGTTC TTGGCTGTTATTTAACCTTGTGTACTTCTTAGATGTTGTATTGCTGTCGT GGGTTCGAAGTCCCTTTGCTGTATCTTTGATTTGGAGAGTGAGGGTTTGA ACCCATGAGCTGGATC
Download
page-top