Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415811
Length 403 bp
Fasta Format > MUG001.C08R990520
CCCCCGTCGTCGCGGCTCCAGCTTAGGGTTTCTCGCCCCCGCCTCCCGNC TCACCGCGGNCCCGTACGCCATGTCGAANCAAGGAGGGAAGGGCAAGCCG NTCAAGCAGGCCAAGGTCGCCGAGAAGGACTACGACGAGAATGACCTGGC ATACCTCCAGAAGAAGAAGGATGAGCCAAAGGCCCTGAAGTGAGCTGAAG GCCAAGGCCAGGCCAAAGGGTGCGCTGGGAGGATCTGGTCTCAAGNAAGA NTGGGAAGAAATGAGTCTGCCANCCTTACGTAATGNGCCAGAAAATGATT ATCTATCTATCTACCTATCTGTGTCCGCTTCACGTATCTGTGGTATGTAA AAGACTANCTTCAGNTTGTGTTGAGCATTAAGCATTGTCGCAGTCGGTTG CTG
Download
page-top