Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415810
Length 747 bp
Fasta Format > MUG001.C07R990520
ACGTTTCCGGAGGTGGATTTGATTGGGGGCAATGTGGTGACAATTGGGCA GGCACAGAATTTGATTGCTGCTGGAGTGGATGGCCTGCGCGTTGGAATGG GCTCTGGTTCAATTTGCACTACCCAGGAAGTTTGCGCTGTGGGTAGAGGA CAGGCCACTGCTGTTTACAAGGTTGCGTCATATGCCAAGGATCATAATGT GCCAGTTATAGCTGATGGTGGTATTTCATACTCTGGCCATATTGTGAAGG CTTTGTCACTGGGCGCATCAACTGTTATGATGGGCAGTTTCTTGGCTGGC AGCCATGAGGCTCCTGGGCCTATGAATACAAGGACGGCCACCGAGTAAAA AAATACAGAGGTATGGGCTCCCTCGAAGCCATGACAAAGGGGAGCGATGC AAGGTATCTTGGTGATACTCTGAAGCTTAAAGTTGCCCAGGGAGTTGTTG GAGCGGTAGCTGACAAAGGTTCTGTTCTGAGGTTTATTCCGTATACAATG CAAGCTGTTAAGCAAGGATTCCAAGATCTTGGTGCATCCTCTTTGCAGTC AGCTCATGATCTTTTACGAGCGGAGACTCTTAGATTAGAGGTGAGGACCG GTGCCGCCCAAGTGGAGGGAGGGATCCACGGGCTGGTGTCTTACGAGAAG AATCGTTCTACACCAGCTGAATCGAGGACGTCGAACCGGTTCTCTGCGGT GTTCATCCAAGGGTTGGCAGGGGTCACCTGATAGTGGTTTGAAGCAG
Download
page-top