Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415808
Length 309 bp
Fasta Format > MUG001.C05R990520
CAAGAAGGCCGCGCCGGCGAAGAAGGCCCCCGCCGCCAAGAAGGCCAAGA AGTAGATCCTTGGAGGAAGATCCTAGGGCTTGGCGATAGTTTTCCAGTAG CAGTTTTTTCTGTTCTGTGCTGTTAGTCGGGATGTCCGGCTGTGTCGACG GTGCTAGACTGTAAATTTGAAATCTGGGTTTGGGTGCAGCGGATCACCGG TGCACCCCTTGGTGTGTGTTGTGAGGAAACGGTGACGACGATCGCGCTGT AGTAAGCTTATTATGTATTTGTGTAACTGAATTGGGTAATTGAATCTTAA TTTTAGCCC
Download
page-top