Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415806
Length 669 bp
Fasta Format > MUG001.C03R990520
CAAAAAAACACCAACCCCCCCTGCTGCCCCGATCCCCACCTCCTCCTTCG ATCCACTCCCCCGAATGCCAGATCTCGCTGCCACAGCACGCCTCTGGCTC GTCGGCTCCTCCCTGATCCAGCGGCGTCGAGCTCTTCCCCTCCTGCCACA AGCGCCGCCTGCTCCCTGGCTACGCCGCCGCCCCCTGACCCCGACGCGCC TCCCGCCACCGGCCACCTTGGCCGTGTCGTCGCCCCCCTGATGCACCTCT CGCTGCCGATGCTGTCGCCCCTCCCGCCGTCGTCCACTCCGAACCCGTCG CCATGCCTCGACCCGCAGTACACAAACAACGCCGGCGGNCACCACCTCCA GTGGTTGCACTTTGGCGGCCGCCGGTGGCCTTTCACCAGCGCTGGAGCCA CCCCCCGCCCGGCCCCGTCCCCACGCTTGGATCCGCATCGGCGCCGCCCG GTGCCTGAAACGGCACCAGCTCCACCCGCGCACCTGGATTCGGTAGCCGC ACCACCCCCGTGACTGGATTCGGCCGCCACGCCGTTCTCGAGCCAGTTTC AACATCCTTCTCCGCATGAGGATTTGAACTTCTTTNAAATTTGCNTGAAA ATTGCCTGCAAAATTGTGTCTGTAAATTTCGCTCCTGAATACAAGTGCGG TTTCTGAAGAGAAATTTTT
Download
page-top