Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415804
Length 727 bp
Fasta Format > MUG001.C01R990520
CGCTGTGCTCCTCCCAGGACTCCAATGACGTGGTCGTCGCCTTGCTCTCG GCGTTGCAGCATAATCAATCCTCAGACATTTCCCACAAGTTGGTCAAGCA GATAGCATCTCTCCCTTTTCCTGCTCCTGGTAGCAGCAACCTTCTCGAAC CATGGGAGCTTGCCGCCCGCCGCAGGAAGCACACCACCAAGGTGACCCAC CAGTATTCCTGGTCACTGAGGCGAGTGCTCCTACATACGATCCATGGTTT CTACCTGCAGGCACTCGCCAGGATGCCGGGTGGCGAGCTGCGGTCTCGTT ACCACCGTANCATGCTCAAGGCTGGCCATTGCTATGGCCCTTTTGATCCT GTCACCAATATCATCGTCAACACCATCTGGTACGAAGTCACATTCCCACC ACTGAGTCAACTGGACGAGCTCGACATTCTTGGCACCTTGAACCTAATGC GGATTGAAGCACAATCCTTTTACGGACTTGTCTCTTTCCTCTGCACCCGT GACAAAGATCTCAACTCCGATCAGGCCATAAGGTTCTTGCTCGACACGGA TCTCGACTTGGCCGCGACAAAGCACTGCAGCACTGTCCAGGATGAACAAG AAGCCTTCAGAGCTGCTGCAACTGCGGCATGGCACCCCATACCTGATGCC CAAGTAGCATTCCTCAGCTCCTGCAAGACGCCTGCAGTCCTCTCACTGNT GTTCNGATAATGGAGGTCAACAACAAG
Download
page-top