Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415800
Length 718 bp
Fasta Format > MUG001.B09R990520
GACTTCTGCAACCGCGCGGTCTCCACCATGCACGCCGTCGCCGGCGTCGC CCTCGGCTGCCTCTCCGTGCAGGACTGGGCCTCCCCCGTCTCCCCCGTCG CCTCACCCTCCTCGCCAAGCCAGATGAGGGCGCTGGCGGTGACGCTGTCC TACATGATCTACGACGGGGCGTGCTGCCACCTGAGCGGCGACGCGCGGCT GGACAACGCCTTGCACCACCTCATCAGCATCGTCGGCCTCGCCGCCGGCC TCGCCTACCAGAGGTGTGGGACGGAGCTGGTGGCGTGCCTGCTCGTCACG GAGATATCCAGCCCGCTGCTGCACCTCAGGGAGATGCTCAAGGAGCTCGG CGTCAAGGACACGGACCTCAACCTCCTCGTCGACATCCTGTTCGCGGTGA CCTTCTCGGTGGCACGGATGGTTTGCGGGACGTACGTCACCTACCGCACT GTCACGGCTGACAACCCCATCCTCATCAAGGCGATGGCGACGAGCTTGCT GCTGGTGAGCGCCTACTGGTTCTTGAGGATCCTCAGATGGTCAGGCACAA GATTGGGAAGAAGAGGCTGGCGTCCAAAGCCGCCGGCAGAATCTATGTGA TGCCACAAGTGGTGTCTCGCCGNNATTATTGTTGAANATGCCCNGTTNTG TTGTGTACTAACTATNTTACGCNTTAACGGGTGGGGGGGNAAGGANTAAT GTCCCCCTATGAAATGCA
Download
page-top