Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415799
Length 720 bp
Fasta Format > MUG001.B08R990520
CTTACGCTTTGCTATCTCCATGGAAGGGTGTATTTGATCCAGCAAGTTGG GAAGACTTGATAGTGCGTTATATCATTCCTAAACTTAAAATGGCACTCCA GGAGTTTCAGATCAACCCAGCAAACCAGAAGTTCGACCAGTTTAACTCGG TTATGATTTGGGCTTCTGCTGTACCGGTATCCCATATGGTCCATATGTTG GAAGTTGATTTCTTTANCAAGTGGCAGCAGGTTCTGTACCATTGGTTGTG TTCAGAGATTCCCGATTTCAATGAGATCACAAACTGGTACAAGAGCTGGA GGGGTCTTTTCCCACCAGAGTTACTCGCCAATAAACGCATACGGATGCTT CTAACGGCTGGTCTTGAGATGATGAACCAAGCTGCTGAAGGGGTTGACTT GGTGCAGCCAGGGGCAAGTGAGAATGTGGGCTACTTGAGAGCAACAGAGA AGTGGCAATTTGATGCAGCACAGCAAGCATCGCAATACCCAGCTTATCAT TCAGTGCCAGGTGCAACCATGGGAGATATGAGCTTCAAGGAGTCTATTCA GGCATATGCGGCTGACCAAGGTTTGCTGTTTATGCCTAGAGTTAATAAAT CCTATAATGGCAAGCCAGTGTATGAATTTGGCACCGTGAGTATCTTCATA GACTCTGTCAAGNCGACTACTCTAATGCGCACTTCAGAAGGGAACCGATA ATGGAGTTCCGGTCTCTTAC
Download
page-top