Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415797
Length 862 bp
Fasta Format > MUG001.B06R990520
GACAAGTGCTCCGGCTTCTCCACCGACGCGCTCCGCCTCGTCGCCCGCTC CTGCAGATCCTTAAGAACATTATTTCTTGAAGAATGCGTGATTACTGACG AAGGTGGTGAATGGCTTCATGAACTTGCTGTCAACAATTCTGTTCTTGTG ACACTGAACTTCTACATGACTGAGCTCAAAGTGGTGCCGGCTGATCTGGA GCTTCTAGCAAAGAACTGCAAATCATTACTTTCTTTAAAGATCAGTGAGT GTGACCTTTCAGACCTGATTGGTTTTTTCGAAGCAGCCAATGCATTGCAA GATTTTGCTGGAGGATCGTTCAATGAGGTAGGAGAGCTAACAAAGTATGA AAAAGTCAAGTTTCCACCAAGAGTATGCTTCTTGGGGCTTACGTTCATGG GGAAAAATGAGATGCCTGTTATCTTCCCCTTTTCTGCTTCATTAAAGAAG CTGGACTTGCAGTACACTTTCCTCAGCACTGAGGATCATTGCCAGCTTAT CTCAAAATGCCCGAACCTATTTGTTCTTGAGGTGAGGAACTGTGATAGGA GACAGAGGGCTGGAGGTTGTCGGCGATACATGCAAGAAGCTACGAAGACT TCGAATTGAGCGAGGGGATGATGATCCAGGTCTACAAGAAGAGCAAGGAG GAGTTTCTCAGTTAGGCCTGACAGCGGTACCTGTTGGTTGCCGAGAACTG GAGGTACATAGCNTGCCTAATGTATCTGAATATCAACCAACACGGTGGCT TCTGGAAATTCCCNTTGGGGGACCTTTCTGGCAAAAATCTTCTTNNCGAA ACTTTCCGGGTGTTCCGGGTCCGAACAGACACAAAGCCGGTNAACTGATC TTGCCCTCACAC
Download
page-top