Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415793
Length 357 bp
Fasta Format > MUG001.B02R990520
CTACAATTCATAACAGGTCTGCGTAGGCGTCGACTATATTGGGCTGCAAT TGCCGGTATAATCACGGATAGTTGAGCAACGCGGAACTTCATCCTTGGCG AAGCTGTGAAGGGACATGGAGAAGAGATTTAGATGACAAAGGTCCGTCTA ATGTCCCTTTGATTCAGAACTAGAAAAGGGCTAGTAAAATACATGGAGAA GAGATTCAGAGATTTAGGGGTGGCATGTAAACACATTCTCTATTTTCAGG ATGATTTACCACTACCTGTAACTTGTAAATTAGTAAAATACAAAGCCTCG TCAAGCCAGATTATCTAACAGCAGTAGACTTTTCAGCCAGATTAATTATT TGTTGTG
Download
page-top