Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415786
Length 516 bp
Fasta Format > MUG001.A07R990520
AAGCAGCTGGCCACCAAGGCGGCGCGCAAGTCGGCGCCGGCCACCGGCGG CGTGAAGAAGCCGCACCGCTTCCGCCCGGGCACCGTGGCGCTCCGGGAGA TCCGTAAGTACCAGAAGAGCACGGAGCTGCTCATCCGCAAGCTGCCCTTC CAGCGCCTCGTCAGGGAGATCGCGCAGGACTTCAAGACCGACCTCCGCTT CCAGAGCTCCGCCGTCTCCGCGCTGCAGGAGGCCGCCGAGGCCTACCTCG TCGGGCTCTTCGAGGACACCAACCTCTGCGCCATCCACGCCAAGCGCGTC ACCATCATGCCCAAGGACATCCAGCTCGCAAGACGCATCCGGGGCGAGAG GGCCTAGGATAGTGTCTGTCTCTTCTGCAGGTGTAGAGATTAGCATGTGT TTTGCGTGGTGGAGTGATCCCGTGTTCGTGCTATGTTGGGTGTGTGTGAT GTTCTAGTGCAGTGTCTGATGTTACCATCTTGTTGTCATCAGCAATCTGA ATGAAAGTTGGCTGTC
Download
page-top