Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BE415783
Length 820 bp
Fasta Format > MUG001.A04R990520
AACGCCCAAAGCCTCCGCATCCAGAGCTCCAAACCCTAGGCGAGGCGAGG CGAGGCGAGGCGAGGAGGCGGCGCGGCGAGGGAGAGGCCATGGATCCCGA TTCGGTGTCGAAGGCGTTCGTGCAGCACTACTACCAGACGTTCGACTCCA ACCGCGCCGCGCTGGTGGGGCTGTACCAGGACGGCTCCATGCTCACCTTC GAGGGCGAGAAGTTCGGCGGCCCCGCCGCCATCGCCGGCAAGCTCGGATC TCTCCCCTTCCAGCAGTGCCAGCACAAGATCGACACCGTCGACTGCCAGC CCTCGGGGCCCCAGGGCGGCGTCCTCGTCTTCGTCTCCGGCACCATCACC ACCGGCCCCGGCGAGCACCCCCTCAAGTTCTCACAGATGTTCCATTTGCT GCCAGCTGGAGGGAGCTTCTACGTGCAGAACGACATGTTCCGCCTGAACT ATGGTTAAGGAAGGGCGACTCTGGCAGCAAAGAACTTGTTCAGGGGATTT ATGTTGAAACAATGAACATCAAATGATGATGCTGCAGACTCTTAGTTATG TTCGCCAACCTGTGCAATTTATCGCAAAAAATTGCCTTGATAGGCATCCA CCAGATCATCTTGTAGTGTTCCCATGTATTGTCGTTGCTTGGGTGGCACT TTCTTTGGAATGTTGATGGAAACCGCCCAGGTATTAATTATGCGTGGCTC CGGGTNTGGTGGGGACCTTTNAGGTTCACCGTTTTGGCCTGTTCCCCCAA AAGTTTCTTCCCCCNTGGCTCCCGTGAAAATTCTTACAGGGGTTTTTCCA GAAGACAAGAACAACACCCC
Download
page-top