Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ736966
Length 154 bp
Fasta Format > rwhsh9o10
atatataggggagccaatatatacatggatcagcgtgcagtgcatgtagt aattaaacacagggcaaaatgtcaatctaacctgtgcagtttaatcctaa gcgagtgtgacatcaatgagtcatcaaattacatttcagggaataagaga cggc
Download
page-top