Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ736927
Length 218 bp
Fasta Format > rwhsh9k10
gattttttttatgagtacataaatattacgacaacttattcggtgcaatc ttgtcacacatgcacgcatgaatagcatgcgcctgcaatcgacgtacgga ggatcggtcgatcgattattcactcaaatcgcttcattttttgaccgtcc aaaaaataactaatgtaagcccccggccatcttcaccatcgatcagtgcc tctgaaggaagtcctggc
Download
page-top