Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ736901
Length 719 bp
Fasta Format > rwhsh9h18
atttttgttggacaagatgcttgttctctttctcatgaatagaatggtcc ctttctttcttatacgcttcccttatttttgcgtccatactttagcacag ctgggacgtgtacattcaggagatacgtgtgccagtccatagatttgaga tcaaagttaaatatgtcactagcattgccatccatttttacttccatcct caacctcctcatgttcgtgtcatcaaagcatcctttgaagaaggcatatg gcgcatacagcttgaccaagagcattaagaaattgtatcttcggttttgc ttattgtaatattgtgaaaacaacccacaaaataacaggctcacggcatg taacatctcaagtggtagcttatacaccagtatcagatatgcgcggaata aagcgaatctcttaaacacgtatggccttttgtttttgaggggtttccca ttctgtatacgaggatatatggagaagtaatcccaacatgcgtcttctaa gccataacccgtcaatggggttttggagtgctgagcacacgttgtaaatg acttgtcctttctcattcaaatgaacagccatggctaccagcgttgcatt taccaccatgtccgcaggaactgcatccattgtgtctttgcgatcaccta cgaaacatgggaatgcttgctcagtgtangcgacaatcatagcatcaatt gtcctcgccccttctatcc
Download
page-top