Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ736779
Length 757 bp
Fasta Format > rwhsh18l16
cttgcttctcggtgcgcaacatagcatcagggtaggcggatcaatcccac atatatatgtccacaggatcaactagaaatatagatagataagatagata catggttggtactagatgggatagcaatggcgaagctcctcgtcagcttc tcagaccacaagagcaagagcaccgtcgtggatgggattaggcccccacc aagaaaggacagcgagcgttgttggcctgaacatggcgctcataccgcga catgaccctgccgtcgctgccgatgttgtcgtcctgcgagtggtagccgt ccgacacatccccatccgagtaatccacttggtccgtctgtggcttggtg gactcgatccacgccaggaacgctgccccctcctcatcccgctccaactc caccttcctcttggagccacacttctccgcctccttctccgcctccgcct tggcgtcgaggaagtcctcctccttctccagcagcgccacgaacttgatg agcgcctcctcctcctccttggtgagggtcctcaactccaccttggcctt gacctcctttgacttggcctcgacctccggcttggcctccttcgccttgg cctccttcgccttggccttaacctccggcttggcctcctttgccttggcc tcgacctccggcttggcctccttcgccttggccttcttcaccttggcctt gaacctccggcttggccttctcctccttggncttggnctccttganctcc ggcttgg
Download
page-top