Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ735448
Length 494 bp
Fasta Format > rwhsh10b21
ctactccctctggatcctcaatatggttttaaagaagtaaattttgacca ctaattcatgcatactggttctactagattcgtacaagcttgaatagctc gatgtatgagcaatgcagattcgttgagttgggttcctccggcctcaggc cgtgacaccaggtttcgcccgcgttgcaacggtcggatggtgccgacgga catcaagagcttgcgcaatcaggcgttcaagtcgtagatcttgaaggagt cggcgacgactttgagcctgttgcgcagcctgctccaccgccgctcgttc gccgtcacgatcagcgtgtagtacctcccgtttccgatggcgaccgtcgc aaacgccgacacgccgtagcccggcgcctccagatcgtactcaaatgtcc agtagttcctgccatccaccgtacgctcttgcatttcatagatcgttggt atctggttcggggcagcgtcctcgtgccgaattcggcacgaggc
Download
page-top