Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ735443
Length 545 bp
Fasta Format > rwhsh10b12
cattcttgtttgataaaccaatcaaatactgttacatgtcctcatcggac gaataatcatacaggtgaaaaaacaagccgcggtagcggttgttttgttt cacacaacccatgtttgttccatgcatcccaagtcccacagggcatcgcc tcatattcacttgccggggacgaagttggtggcgaatgcccaggcgttgt tgttgacgggatcggcgaggtggtcggcaaggttctcaaggggacccttg ccggtgatgatggcctggacgaagaagccaaacatggagaacatggcgag ccgtccattcttgatctccttcaccttgagctccgcaaatgcctcagggt catcagccaacccaagggggtcgaagctaccgccggggtagaggggatcg acgatctcaccgagcgggccaccggcaacgcggtacccctcgacggcgcc catgagcacgacctggcaggcccagatggcgaggatgctctgcgcgtgga cgaggctggggttgccgaggtagtccaacccaccctcgctgaagc
Download
page-top