Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ734279
Length 464 bp
Fasta Format > rwhsh2h18
ttgagtcgactcgatgactcagatttagcaatcccgctccacattagtac attgtgtcatacacgcacgtacatatactccacggtccacagaaagcata tatctatacacaggcacacagttattaacacgagacctcacacatccggc gcaacgcggtaaaagaaactaagaaagaagaaaaatcacggtgaaggatg cagttgggaacccgggaattctacaggacctcgatcttctctatatggat cagttcctgtaggattcctgcgtcccacgcaactgcaagaaaacagggga ggacgagaggaggaagacgaagacgcgaccgatcgacgggatcgatgcac atatatgcgcagaaggaggcgtgaagtggagaagggacgtcgcttagggg aggctctacttgtcgatctgcccgagcttgccgagtccgttgcagttggc gcacacgatctgcc
Download
page-top