Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ734186
Length 226 bp
Fasta Format > rwhsh2a06
aaatttgcattttattactaaaatttacatgtgccattttattagtacta aaatctacatgttccagatatgtaaaatcaattaatcatcatttctgtag agttctcctgtaaaataatctacacacaaacacagtaatttacatccact ttagctacacatagaacacctgcccaacattcagcaggctctcatgggga acattgaagatggcgctgttctcccc
Download
page-top