Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ732702
Length 222 bp
Fasta Format > whsh10e17
ggggcctcgtgaagagacacgaaagctctcttcgatcaattccttgttta agatctgtattagactacttccaagccttgtacaaatcaccacgactctc cctgcttcccctgtctcctcagtaactgtttgtatccattgtaaatgctc attcagccatgttgccggacatatatgttataaccactgccatgctaagt attctctgctttaaaaaaaaaa
Download
page-top