Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ732653
Length 617 bp
Fasta Format > whsh10a03
gaggcctgtcttacttgccacccctctccacggaagccctcctgaagcag gtcgactacctgatccgctccaagtgggtgccctgcctcgagttcagcaa ggttggcttcgtcttccgtgagcacaacagctcccccgggtactacgacg gtcgatactggacaatgtggaagctgcctatgttcgggtgcaccgacgcc acacaggtgctcaacgaggtggaggaggtcaagaaggagtaccctgacgc ctatgtccgcgtcatcggcttcgacaacctgcgccaggtgcagtgcgtca gcttcatcgccttcaggccaccgggttgcgaggagtccggcaaggcctaa actatgagttgaaacaatggcctatctcatatgaagatcttttgtgaatt tcacttttgtccacgacctctgttgcacgactctgctttccgaccggagc ataccttttgttctatatgatttgtgtatgtatgtaggaacctatgttct cgagcatgcatacataattcctcataggtctatatacaccggctatccat atgcaaaacctgtgtaatatttgttatatacaacacgcggaccattgtct tgctgttaaaaaaaaaa
Download
page-top