Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ732636
Length 195 bp
Fasta Format > whsh9o10
cgaggccgtctcttattccctgaaatgaatttgatgactcattgatgtca cactcgcttaggattaaactgcacaggttagattgacattttgccctgtg tttaattactacatgcactgcacgctgatccatgtatatattggctcccc tatatatacctctattggtgaaaagttttgactttaaaaaaaaaa
Download
page-top