Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ732634
Length 662 bp
Fasta Format > whsh9n20
acatttctttattcctgaaatattcaaggatctaaaaaaggtggttgtat tggatgatgatgtggttgttcaacgtgatctgtctttcttgtggaaactt gatatgggggacaaggtaaatggtgctgttgaattttgtggtgtaagact gggtcaagtgagaaatctcctgggtaagacaaagtatgatcctaaatcat gtgcatggatgtctggggtgaatgtgatcaatttggataaatggaggaag cataaaataacagagaattacctgctgctccttaaacaggtcaagaaaaa agacgaggtatctctgagagaagctgccttttctttaagcctgttgtctt ttcaaaatctcatctacccccttgatgggaggtcgactctgtctggactt ggatatgattatggaatcgatccggaggttgcacagagctctgcagcatt gcactacaatggcaatatgaagccttggctcgagttaggcatactggact acaagaagtactggaggaggtttctcactcgagaagatcgattcatggat gagtgcaatgtaaatccgtagcacacttgatcagaactatcgacaacagt ttgagacatccactggcctcctcctttgaatccttctctgtctgactgga tgcctgtagctc
Download
page-top