Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ730949
Length 168 bp
Fasta Format > whsh18f10
acgagggcaaaacgagcagtttttcctatggtgtcatcataggatccgcg gttaccattctaaaacctacgctagttattatggatatgtcctcagattt tactgcagtgtagcgagtaaattatctgatggaataatgatatcaaaact ttgtgaccaaaaaaaaaa
Download
page-top