Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ517847
Length 753 bp
Fasta Format > rwhfl8h15
cttcgaattgcttcggtctttgctaatacagagcagctcaaagttcacac acatgaccaccaaacgttacaactcatgtattcccatgtaaacaaggaaa aactgacataatatcacaggctgggcacggctagttcgtcagttccatga tagcactgactatgtcaccgtcagcagacttgagcgccttcacagccttg ggcctaggcacaccggcctgggtcatcaccagctcaatgtccttcggctc aaccccagtctcatcacaatcctcgtcatcctcctgaacagctgtagaag cctcagggtttgagatgacgctgctaagatcaggcgccttgaattgctcg gcggcctgggactgcagctgtgagctcagatcctcaatcttagcttcacc gaaaatgacataggtgtcagaggcagggctcttgaatacatctggcttgg agatgacaaacaggatattcttgctcttcttgacagttacacggctgacg ccagtgatagtcttcatgccaagcttcagcatggccttcctgctcttctt ctcactcctactctgcttagatcttccacttgcatcaactccttccacgt catcgtctttgtcatcctggtcatcatcatcctcatcttcctcatcatca tcatcctcaactacaggctcatctccctgcgccgcgagcttctgctcttc caggacggcgcgtagcagctccgccctgcgtcgcggtctcggccgtcatg gtg
Download
page-top