Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ517445
Length 503 bp
Fasta Format > rwhfl6k18
actgattgcattgaacaggtattacacagcctactgaacccaagacagaa cacaacgacgcacgccaaagcagtaaatcccatctagcacgatacatgtc acacagagcaaacgaggaagttgctccactagacggatctagcctccgaa gccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcgg atgacgttctcgaggaagatcttgaggacgccacgggtctcctcgtagat gaggccggagatgcgcttcacgccgcccctcctggccagcctccggatcg ccggcttggtgataccctggatgttgtcgcggaggaccttccggtggcgc ttggcgccgccctttcccagccccttgccgcccttgccgcgcccggacat cgtcgatggatctgggagaagaagggagtggtgtggatgttgaagcttgg gat
Download
page-top