Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ517284
Length 719 bp
Fasta Format > rwhfl5p01
tgagataaacagcaacatacagagggtatttcaggtctaacaaacacaat acaacacgggtacatgataaacagacacagacaaacagacaacggtatat atgtccctaacattaacaagttagacaaacagacgatatggtggggtggg ggtggggtacaggtatgtcgcgccgggcacggtgacgaacgccggccata caaaatgtaactaaatgcagagcctactttaccggttctcatcacccagt accgtcagactggctaaattaacatgcttaccagaggctgattgattaca atgcgaatgttgaatgatcctaggagacggcggcacggaggagggggcag ctgcttcaggtgcacttcaccgtcgaggcgccaggcgacagctgcccatt gttgacggcggacggcgactcattggtggccgcgccaggttggctgtcta ctgcggcggcatctgatttggtttcagatactgcagcaggtgcaggagca atagcaggctcgctgggagcagcaactgagttctcagttggcttgctcgc tggaggggctacttcctctgtcttcgccccctccgaactcaccggaggag cttcctctgtcttcacctcctccgaactcaccggaggagcttcctctgcc ttcaccttctccgaactcaccagangagcggcatcagcctcagatgactt gacatccttccttcttgtc
Download
page-top