Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ517197
Length 743 bp
Fasta Format > rwhfl5j04
attaacgaaaatcaaaccatcaccagtgcgcacgaatcgatacgacacac actctctctagcagacgagatcaaaagacagagaaaccatcactcatcat cacaggaaactcagtacccactcagccactcaaactctgcttcgattcga cgcgcacacaatgcataccagctcaggcaacctggacctggatggtcttg ggcttcttgggctcgggcggcggcagcttctcgacggtgacggtcagcac gccgtcgcggcacgcggcggagatcttctccatgtcggcgttgccgggga gcatgaacttgcgcatcagcttgcccatgcggcgctccatcggcaggtac ttggcgtcctccttctcctccctcctccgctcgccgctgatgaccagtac ccgctcgtcctccacctgcacctggatgtcgccggaacccagccccggca tgtccaccacgaacgcgtacgcgcccggcagctccttcacgtccgccggg gtggctgccatggcgcgcgcgtcccggacgtaggcacgtgtagggccctg cttctcgccggcggcgacgccggcctcgccgtctgggatatccagcaggt gctgcagtgccgtcatcatcgggttctccaagccgaacaccatgcccgcc attctcgctcgctgatctcgagctcggtcgatctcctcgggttggacttg cgttggattgcttgttgaattttgtggaatgctttggtcggtt
Download
page-top