Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ516856
Length 666 bp
Fasta Format > rwhfl54j05
aacgataaactggagtgccaaacataacatagcaggagatgggacacagt tagatagtaaacgagccatcctctgagttgaatttcatggcttgcactct gtcttcaagactaatctttaagaaacacaacttcatcatcaatgacgaca taatcaacaagagcgtcagctttcgtaggaacgtagggaatataaccgtc tgtgtcctccgggctagcaacatacttgcggctacagggattagccgccc gaatcctcctctgttgttcgagacacaactcattgtctctttccctcttg gcgatgaagtcttcatcgacctcgaagtagcccttgtcccgcacagacgc gatgacctgctgcctgtactcttcgaaatcatcgtccatcttcttgaaaa gctttacgctgtcggcgtgggcacgcttcctttcctcaatccactccgga gggaaatactctgccagatcgtccaggtaatccgcgctgggttgttgctc cggcttcagggcaattatgctcctaatctcggctttcgacagccgaacct tgcccttgtttgggacctggtggtgctgcggctggctgattggatgacag attcgcctccccaagcatcttctcaatcgcagcaaaccccttctctgact cgtcaccctccttgta
Download
page-top