Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ516844
Length 758 bp
Fasta Format > rwhfl54i05
gcgtgctatggtattttcattcggacggaaaaccaagtcatgacaagaac aaatgacacacgacacccgatatggtacttcaaaatgaagttctatacaa ccaaaaggtggatcttcattatgcccattatatgtacctccaagacgaaa tagaggcataaatcacaccatgttgaagcatcaaagagtttttacaataa ggcttaggttagatcatcctcatcatcctcttgtttcttcagctcattct ttgccctcagcagcagtgtcgttttccaaggatccaggcgtgtcatgccg tcaaattccttgatggcatcagtaaatttggcaatatctccatcgtccat tgatgcagcaagatcagctaaaagtttgtattcacgagttcctgagaaag tcggatcgatttcctggtatctctccaacgaattttgtatagcaacagca tcagctctacatagttggcagattcctgcattaaggaggatgcctctgac actatacttcagcagattgttgttaattgattgacgagcaatttcttcaa aaatctcagttgcctttgggtactgttccaactgcgcagcaatttctgca actttctgcttaatggtgtttgattgagatgtctgtccttcactgtcgaa aagatcagcggccctttctaggtaatctgaagccttctccaaatcctgtt cttgctgataaatctcaccaatgtccttgcagtatcttgcagccatgctc aatctacc
Download
page-top